snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA50
sequence
CAGCACTCCACTGAACCTAACGGGCTTTTCCGTGTCCGTTCGCGGGTCAAGCGGAGTGC
GAGACCATATCTTGTCATAACTGGGGTTTCTTGGCACTGTCACCAAGTAGCTCTTTTAAA
GCAAGACACACTT
  Box motif
  Complementary to target RNA
length 132
organism Tetraodon_nigroviridis
snoRNA name SNORA50
alias
chromosome ⁄ contig 3
locus ⁄ host gene Mono:SNORA50
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved