snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA75
sequence
CTCTTCTCATGAGCACCACTCTGTCTAACGGTGACAGTGAATGGATTCGCAAGAGAAGT
AGAGCAAAGTGACATTTACACAAGGCATTTACCTAGTGGTAGGTGCCCATGTCCAATGTG
AGACATTT
  Box motif
  Complementary to target RNA
length 127
organism Tetraodon_nigroviridis
snoRNA name SNORA75
alias
chromosome ⁄ contig 1
locus ⁄ host gene nucleolin
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved