snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis snoU109
sequence
GAGCATGTTTGGACCGATGGTCATCACTGTCCTCTCAGGTTTTGTGGAGAGGATGAATG
CAAACATGCTACATTAATACTTGAGGAGTTAACAGGGCCACCAGTCTTTCAAGGACAGGC
TGGGTCGGTAGTATAATACTCCAACACTG
  Box motif
  Complementary to target RNA
length 148
organism Tetraodon_nigroviridis
snoRNA name snoU109
alias
chromosome ⁄ contig 1.0
locus ⁄ host gene fam122b
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved