snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORA70
sequence
GTGCAGCCTATTAAGCCGACTGGTTCTGCTGTGGTGCGGTTCTGGTGTGCAAAGGCTGC
AGACAGTGACTCTCTGGTTGTGTATGTCCTCAGCTGGGAGGTGCTGAGATCATTAAGGGA
CCACTGAGACAAAC
  Box motif
  Complementary to target RNA
length 133
organism Takifugu_rubripes
snoRNA name SNORA70
alias
chromosome ⁄ contig scaffold_2483
locus ⁄ host gene RPL10L
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved