snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD66
sequence
CTCCTGTGATGACTGATGCTTTGTGCCACGTGTCTGGGCCACTGAATGATCGTGATGGC
TTTGAGGATCTGATGGA
  Box motif
  Complementary to target RNA
length 76
organism Takifugu_rubripes
snoRNA name SNORD66
alias
chromosome ⁄ contig scaffold_344
locus ⁄ host gene ENSTRUG00000005806
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved