snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD24
sequence
TGCATATGATGTAAACGAATATTTGCTATCTTAATGACGATGATGACAATATCCCACCA
AGATCGCTGATGCA
  Box motif
  Complementary to target RNA
length 73
organism Takifugu_rubripes
snoRNA name SNORD24
alias
chromosome ⁄ contig scaffold_49
locus ⁄ host gene RL7A_FUGRU
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved