snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORA57
sequence
CCTCTATTTCTTGGCATGCATGAGTTGTTCAGTACTCAGGCGTGTAATGTACGGAGGAA
AATGAAGTGCAGTGCTATGTCTTCGGTGCCGGTGCGTTTTCAGGTCTGCCGGTTCTATCC
TCAATCACTGTGACATTA
  Box motif
  Complementary to target RNA
length 137
organism Takifugu_rubripes
snoRNA name SNORA57
alias
chromosome ⁄ contig scaffold_43
locus ⁄ host gene NCL
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved