snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD16
sequence
TGCCATGATGGTGTAATTTGCGTCTGATCCTGTGAACAGTGACAGTTGCCTGCTGTCTA
TATGCTGTCATGGGTACTTGATGTATATTAAAGTCTGAGCA
  Box motif
  Complementary to target RNA
length 100
organism Takifugu_rubripes
snoRNA name SNORD16
alias
chromosome ⁄ contig scaffold_2
locus ⁄ host gene RPL4
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved