snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD52
sequence
TGGAATGATGATTTTGCAGACTAGAGTCTCTGAAAATCCTGAAGTAGCTTTCTTTTATT
GCACTGACCA
  Box motif
  Complementary to target RNA
length 69
organism Takifugu_rubripes
snoRNA name SNORD52
alias
chromosome ⁄ contig scaffold_291
locus ⁄ host gene Mono:4:SNORD52
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved