snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD75
sequence
AGTCTGTGATGATAGAGATAAGAGTAGTGGACAGAAGAGATTTCTGAACAAAAGTATGC
TGAGACT
  Box motif
  Complementary to target RNA
length 66
organism Takifugu_rubripes
snoRNA name SNORD75
alias
chromosome ⁄ contig scaffold_122
locus ⁄ host gene Poly:1:snosnR60_Z15
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved