snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD22
sequence
CCTTGGTGATGACACCCGCACACGTCTTACGCCTTGCGTCAACGCCAGAACCTGAAAAG
GTGAACCCACTGGTGTTGCCTTGGCAGGAAGGGGAAGACTTGTTGGGGTTACCAACAGTC
TGAATGGA
  Box motif
  Complementary to target RNA
length 127
organism Takifugu_rubripes
snoRNA name SNORD22
alias
chromosome ⁄ contig scaffold_315
locus ⁄ host gene Poly:3:SNORD30
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved