snOPY snoRNA Orthological Gene Database
Takifugu_rubripes SNORD49
sequence
GTCAATGATGAAATCCTGGAATAGGAAGTGCCGTCAGATGCGACAACTGACGATTTCTC
ATCCACTTTTCTGAGG
  Box motif
  Complementary to target RNA
length 75
organism Takifugu_rubripes
snoRNA name SNORD49
alias
chromosome ⁄ contig scaffold_242
locus ⁄ host gene Poly:2:SNORD49
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved