snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD111
sequence
CAGCTGAAGTGATGATCACATCATGTCTCTTCTCTGATAAATTTTTGAAGGAAATTCTG
TGTATCTGATCAGGCCT
  Box motif
  Complementary to target RNA
length 76
organism Spermophilus_tridecemlineatus
snoRNA name SNORD111
alias
chromosome ⁄ contig GeneScaffold_3637
locus ⁄ host gene SF3B3
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved