snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD45
sequence
GGTGAAGGAGGCTCGTATTACCTGAATTTACTGCTTATGTGTGATAGCACTTCAGCTCT
AGAATTACACTGAGATTTT
  Box motif
  Complementary to target RNA
length 78
organism Spermophilus_tridecemlineatus
snoRNA name SNORD45
alias
chromosome ⁄ contig GeneScaffold_3799
locus ⁄ host gene TMEM16K
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved