snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD110
sequence
TTGCAGTGATCCGACTTGTGAAATCTGTCAATCCCCTGAGTGTGATCATTGATGTCTCA
ATGTCTCTGAGCAA
  Box motif
  Complementary to target RNA
length 73
organism Spermophilus_tridecemlineatus
snoRNA name SNORD110
alias
chromosome ⁄ contig GeneScaffold_3276
locus ⁄ host gene NOL5A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved