snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA8
sequence
CACCCTTCATGAAGCATTAAAATTCTATTAAAACTTTAACCTTTTAAATGAGTGTGTGT
TAGAAATTCATTAACTGACTTTGGTTTTCTTGGCTTTGTGCATATTAAACCTGGTATTTC
TATTGATAAAATA
  Box motif
  Complementary to target RNA
length 132
organism Spermophilus_tridecemlineatus
snoRNA name SNORA8
alias
chromosome ⁄ contig GeneScaffold_48
locus ⁄ host gene AP2B1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved