snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA30
sequence
CTAGCACATTCACAGGTCCTCTCCTGATCTGTGGGGCCAGGATTTGGTAGCTGGTGCTA
AGAGAAAACCCCCTGATTGCATCCTTGCCCTGGTACTGTACCAGTGGCAGATATCATTCA
GTGGGACAAAG
  Box motif
  Complementary to target RNA
length 130
organism Spermophilus_tridecemlineatus
snoRNA name SNORA30
alias
chromosome ⁄ contig GeneScaffold_3706
locus ⁄ host gene SLC25A13
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved