snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA3
sequence
CCCGAGACACGAGTCACATCCCAACATGGCTCTTGTCCTGATGTGCTGGAGTCCTTGGA
GAGGATCTGCTGATCTTGATTCACTGGTGGAGGCAATCAGTGCCCCAGTTAGTACCCAGG
TCAGAAACATGC
  Box motif
  Complementary to target RNA
length 131
organism Spermophilus_tridecemlineatus
snoRNA name SNORA3
alias
chromosome ⁄ contig GeneScaffold_3462
locus ⁄ host gene RBMS1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved