snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD46
sequence
AACTAGAATGATGAAAAAAGTATCCTTAGGCGTGGTTGTGGCCGTATTGGTCACCTGTG
TGCCACTTGCCAGTGGAAGGACTTGTCATAGTTACACTGACAGTTA
  Box motif
  Complementary to target RNA
length 105
organism Spermophilus_tridecemlineatus
snoRNA name SNORD46
alias
chromosome ⁄ contig GeneScaffold_4919
locus ⁄ host gene ENSSTOG00000006322
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved