snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA73
sequence
GGATACTTAAGAGGGTGAGTCTCCCTGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGC
ACTCTGCCCCATGATGTACAGTCCCTTGAAGATGTAGCTGGCCTTTGTGACTGTGCCTGC
ATATTTCTACAACTTCTCAAGAGTCTTGTGGACTATGACTGAAGAGACAAACTATGCAGG
AAACAGTA
  Box motif
  Complementary to target RNA
length 187
organism Spermophilus_tridecemlineatus
snoRNA name SNORA73
alias
chromosome ⁄ contig GeneScaffold_702
locus ⁄ host gene VPRBP
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved