snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD37
sequence
ATGCGTGATGACTGAAATTTCTTCACTTTGACCTGATGTCTGTTGAAGAAACCTAGCAT
CTGAGC
  Box motif
  Complementary to target RNA
length 65
organism Spermophilus_tridecemlineatus
snoRNA name SNORD37
alias
chromosome ⁄ contig GeneScaffold_4301
locus ⁄ host gene EEF2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved