snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA38
sequence
CCCTCCTACAAATGTGTATTTGGTTCCCTGTCTTTGGACACATAAGAATTGAAGGAAAA
GAAAAGTGGATTTGGAGATATCTGGACCTGCTTGTTCCTCTTGGGGTCAGAATCAATCAT
CCCATATGA
  Box motif
  Complementary to target RNA
length 128
organism Spermophilus_tridecemlineatus
snoRNA name SNORA38
alias
chromosome ⁄ contig GeneScaffold_4412
locus ⁄ host gene CDK8
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved