snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA69
sequence
AGAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGCCATTATCCTGCTGAA
AGAAAAGCTATGTTGATCATTTTTGATTTTGCCTTCTGGGGGTAAAATCATGACAGATTG
ACATGGACAATT
  Box motif
  Complementary to target RNA
length 131
organism Spermophilus_tridecemlineatus
snoRNA name SNORA69
alias
chromosome ⁄ contig scaffold_82076
locus ⁄ host gene RPL39
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved