snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD52
sequence
GTGAATGCTGATAGATTAGAGTCTCTGATGCTGTTGATGGGCTAAATAAAAAGAAGGAT
GT
  Box motif
  Complementary to target RNA
length 61
organism Spermophilus_tridecemlineatus
snoRNA name SNORD52
alias
chromosome ⁄ contig GeneScaffold_5063
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved