snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA20
sequence
ATTCAAACAAATCTGTTAGAACTTCTCTCATTCAATACATATGGGATAAAACAATATTG
GGCCATTGTAAATTGAGGTGAAGTCACTTTCATCTCTTCTTCATGGTCTAGATAGTG
  Box motif
  Complementary to target RNA
length 116
organism Spermophilus_tridecemlineatus
snoRNA name SNORA20
alias
chromosome ⁄ contig GeneScaffold_4878
locus ⁄ host gene Mono:200:SNORA20
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved