snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD42
sequence
GAGCATAAGAAGAAAAATTCTTAATCTCCTGAGACTTGTGATCTCTTTTAAGGAATCGA
CTGATGAAC
  Box motif
  Complementary to target RNA
length 68
organism Spermophilus_tridecemlineatus
snoRNA name SNORD42
alias
chromosome ⁄ contig GeneScaffold_4999
locus ⁄ host gene Mono:186:SNORD42
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved