snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA12
sequence
TTGAGTGGGGGGATTCTTTTCGCTGCATTGGTTTCCAAATGGGCCACTTGTCTTTCGCA
TTATATTGTAGCTAGTAATGTTGAAGACAGAAAGATCTATCTTAAGCTTTTCTTGCATCA
GAGATTGGCTCTCTCATGT
  Box motif
  Complementary to target RNA
length 138
organism Spermophilus_tridecemlineatus
snoRNA name SNORA12
alias
chromosome ⁄ contig GeneScaffold_3649
locus ⁄ host gene Mono:192:SNORA12
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved