snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD19
sequence
GAGGTATGAGGAAAACATCTGAACAGTCTTGATTGTCACTGAAGACTGATAAGATCCAA
CTCTGACCTCAACAAAGCC
  Box motif
  Complementary to target RNA
length 78
organism Spermophilus_tridecemlineatus
snoRNA name SNORD19
alias
chromosome ⁄ contig GeneScaffold_92
locus ⁄ host gene Mono:159:SNORD19
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved