snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA71
sequence
TCCTGCATTCGAAAGTGATCATGGGCTGCTTGTGCCCTGGTCATTGATAGTGCAGGGAC
AGGAATGGCTGGAAGACATTTTCCCCGTGTTTGGAGGGTCCACCCATCCCTTCCAAACCC
TGTAGTTTTCCCACA
  Box motif
  Complementary to target RNA
length 134
organism Spermophilus_tridecemlineatus
snoRNA name SNORA71
alias
chromosome ⁄ contig GeneScaffold_5082
locus ⁄ host gene Poly:9:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved