snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD26
sequence
CTACAGGGATGATTTACGATTTGAACTCTCTCTTTCTGATGGTTTAGTGGAGAAAATGT
AAAAGTTCTGAGTAGC
  Box motif
  Complementary to target RNA
length 75
organism Spermophilus_tridecemlineatus
snoRNA name SNORD26
alias
chromosome ⁄ contig GeneScaffold_5925
locus ⁄ host gene Poly:11:SNORD22
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved