snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA16
sequence
CCTGGCCCTTATCGAAGCTGCAGCTGCTTCCACATAGCTTCTGTGGTCAAAAAGGAGCC
CAGAGCAGCAGTTTTCCTTGACGGTCGCCGTTCTGTTTGCTGTAACTGATCTGCAACATT
TTGGGAAAAGACAACT
  Box motif
  Complementary to target RNA
length 135
organism Spermophilus_tridecemlineatus
snoRNA name SNORA16
alias
chromosome ⁄ contig GeneScaffold_5007
locus ⁄ host gene Mono:155:SNORA16
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved