snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD96
sequence
TCAATTATTTGAGGAAAACAAAAATAACATCTTTGGGGACTGAATAATTTGATGATAAT
AAAGGCAATCTCAATTGA
  Box motif
  Complementary to target RNA
length 77
organism Spermophilus_tridecemlineatus
snoRNA name SNORD96
alias
chromosome ⁄ contig scaffold_158260
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved