snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD22
sequence
TCCCAATGAAGAAACATTTCACACGTCTTACTTCCTGTCCGAGTCCCAGAGCCCGTAAA
GTTGAACCCACTGAGGCTGGCTGGGGGAGAAGAGGAGAACTTGTTCCAGAAAGAACTGTC
TGAGGGAT
  Box motif
  Complementary to target RNA
length 127
organism Spermophilus_tridecemlineatus
snoRNA name SNORD22
alias
chromosome ⁄ contig scaffold_113341
locus ⁄ host gene Mono:8:SNORD22
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved