snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA3
sequence
GCTGAGACTAGAGTCACATGCTGACACAGAACATGTCCTGGTGTGCTACAGATCTCAGA
GAGAATTTGCTGGTCTTGATTCACTAGTGGGGAGGAAGGGTAGTCAGTGTCTTCATTAGT
GCCCAGATCAGAAACATAC
  Box motif
  Complementary to target RNA
length 138
organism Spermophilus_tridecemlineatus
snoRNA name SNORA3
alias
chromosome ⁄ contig scaffold_55531
locus ⁄ host gene Mono:59:SNORA3
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved