snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA38
sequence
TTGTCTTACAAAGGCATTTCTTTGGTTCTCTATCTTTGGACATGTAAGCATTGGAGGAA
AAGAAATTTTGTGGATTTGGAGAAGTCTGGGGCCAGCTTGTTCAGTGTAGGCTCAGGATC
AATCACATAGAACA
  Box motif
  Complementary to target RNA
length 133
organism Spermophilus_tridecemlineatus
snoRNA name SNORA38
alias
chromosome ⁄ contig GeneScaffold_4513
locus ⁄ host gene Mono:172:SNORA38
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved