snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD31
sequence
TACAAATATTTCAGCAGTATTACTCAGCCTAGTGAGACCACTATGTGATAGAAAGGTAT
TTTCTTACCTGTT
  Box motif
  Complementary to target RNA
length 72
organism Spermophilus_tridecemlineatus
snoRNA name SNORD31
alias
chromosome ⁄ contig scaffold_7157
locus ⁄ host gene Mono:89:SNORD31
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved