snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD44
sequence
CCTGGATGATGATAAGAAGATAACTGATTGAACGTGAAGTTTTTAATTAGCTCTAACTG
ATT
  Box motif
  Complementary to target RNA
length 62
organism Spermophilus_tridecemlineatus
snoRNA name SNORD44
alias
chromosome ⁄ contig GeneScaffold_5301
locus ⁄ host gene Poly:5:snosnR60_Z15
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved