snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD28
sequence
GTCAGCTGACTGGAATGAATAAGCTGATGCTCTGTGAGGCACAGAAGTTAATAGCAGCT
GGAGTTCTGATGGCA
  Box motif
  Complementary to target RNA
length 74
organism Spermophilus_tridecemlineatus
snoRNA name SNORD28
alias
chromosome ⁄ contig GeneScaffold_5435
locus ⁄ host gene Mono:150:SNORD28
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved