snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD45
sequence
GGTCAATGATGAGCTGGCATGTATTCTGAATCAAAAGTTGATCATTAATACTTTAGCTC
TAGAATTACTCTGAGACCTG
  Box motif
  Complementary to target RNA
length 79
organism Spermophilus_tridecemlineatus
snoRNA name SNORD45
alias
chromosome ⁄ contig GeneScaffold_2682
locus ⁄ host gene Mono:181:SNORD45
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved