snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA76
sequence
GGGCTGCACCTGCACGTGGCGCCAGGGGTCAGGCTGCAGCGCCAGAGGACATGCTCACA
CATAACTGGGGCCACCTGTTTTGATGGCAGCCCTTTGAACTGTGAGCTACATAG
  Box motif
  Complementary to target RNA
length 113
organism Spermophilus_tridecemlineatus
snoRNA name SNORA76
alias
chromosome ⁄ contig scaffold_145228
locus ⁄ host gene Mono:53:SNORA76
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved