snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORD101
sequence
ATTTGAATGATGACTTAAGTGTCGGATACCCCTTCACTCCTTTCATGGATGAAAACATT
ACAGTCTGACAAAC
  Box motif
  Complementary to target RNA
length 73
organism Spermophilus_tridecemlineatus
snoRNA name SNORD101
alias
chromosome ⁄ contig scaffold_114016
locus ⁄ host gene Mono:71:SNORD101
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved