snOPY snoRNA Orthological Gene Database
Spermophilus_tridecemlineatus SNORA69
sequence
AAAGCAGATTGCTATTATGGTATTCCTTTTCTTGAAAATATTTCAACTATCCTACTAAA
ACAGGCATGCTGATAAGTTTTTATTTTGCCTTTAGGAGGTTAAAATCATGACAGATTGAC
AAAACAACA
  Box motif
  Complementary to target RNA
length 128
organism Spermophilus_tridecemlineatus
snoRNA name SNORA69
alias
chromosome ⁄ contig scaffold_70779
locus ⁄ host gene Mono:10:SNORA69
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved