snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD59
sequence
CCTTCTGTGATGATTTTATCCAAAATTGACTTTCGTTCTTCTGAGCTTGCTGAAGCCAT
AATAGAGAAACTGAGAAGG
  Box motif
  Complementary to target RNA
length 78
organism Sorex_araneus
snoRNA name SNORD59
alias
chromosome ⁄ contig GeneScaffold_635
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved