snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA63
sequence
AAGCAGAATTTAGTCTACAGTTTAGCTGTGAGTGCTATTGTCACTCCCCCTGCTTAAAA
TAAAGTTGTTTCTTAACTACATCTCTCTGCTTGACACCTGTAGCAGCTAGGAATACTTGG
TCTCAGTTAA
  Box motif
  Complementary to target RNA
length 129
organism Sorex_araneus
snoRNA name SNORA63
alias
chromosome ⁄ contig GeneScaffold_4565
locus ⁄ host gene MYO1E
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved