snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD94
sequence
CAGGCTGTGATGATTGGCGCAGGGGTACGGACCTCAGCTGAATCATGGGAGCTGAATGT
ATGTGTTTTGCCTTTGTCCTGCATGTGGCAGGTTGATGGCAGGCACTTACATGAGACTGA
TGCCTTAATCTGAGCCTG
  Box motif
  Complementary to target RNA
length 137
organism Sorex_araneus
snoRNA name SNORD94
alias
chromosome ⁄ contig GeneScaffold_500
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved