snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA58
sequence
TATATATATATAGCTTTGTAACTATCTCACGGTGATACAATTTAAAAAAAAGTAATGTG
GAGTTTATGCCCATTTCAATCAGCTTAATCAATGGCTGAACAAATAGCAGTACTCCTACA
TTA
  Box motif
  Complementary to target RNA
length 122
organism Sorex_araneus
snoRNA name SNORA58
alias
chromosome ⁄ contig GeneScaffold_3624
locus ⁄ host gene DDX52
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved