snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD45
sequence
GGTCAATGATGTTGAAGGCATGTATTAACTGAATCAAAAGTTGATGCAAATTCTTAAGT
TACACTGAGACCTT
  Box motif
  Complementary to target RNA
length 73
organism Sorex_araneus
snoRNA name SNORD45
alias
chromosome ⁄ contig GeneScaffold_3405
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved