snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORD51
sequence
CTGGTTGTGTGATGAATAAAATCAAATCACCATCTTTCGGCTGAGTTCCTGATGGATTT
GCTTTTTTCTGATAACAG
  Box motif
  Complementary to target RNA
length 77
organism Sorex_araneus
snoRNA name SNORD51
alias
chromosome ⁄ contig GeneScaffold_204
locus ⁄ host gene EEF1B2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved