snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA43
sequence
GGCATTTTGCAGCTGCTAAACTTATCCCTACAGATGTGGCCACCGAGCCACACTGGTGA
CAGCAGGGCAGAAAAAGTGGCTATTTCTACACTCAGTGCTCAAAACTGTGGGTGCTAAGA
ATGGTTAGTAGCCTCACATTT
  Box motif
  Complementary to target RNA
length 140
organism Sorex_araneus
snoRNA name SNORA43
alias
chromosome ⁄ contig GeneScaffold_1047
locus ⁄ host gene Mono:733:SNORA43
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved