snOPY snoRNA Orthological Gene Database
Sorex_araneus SNORA42
sequence
GCAAAAAAAAAAAAAAAAAAGAACCGTTCCCCTGGGCCTCTCATAGTGTCCCATGCCAA
AGCAAGCGTGGCCCTGAACCGTTGCCTGGCCCTTGCCAGGCCACTGAAGTGGGTCGTATA
GTG
  Box motif
  Complementary to target RNA
length 122
organism Sorex_araneus
snoRNA name SNORA42
alias
chromosome ⁄ contig scaffold_165070
locus ⁄ host gene Mono:212:SNORA42
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved